First appearance of the cave leech Erpobdella mestrovi (Annelida: Erpobdillidae) in Iraq (Morphological and Molecular investigation) from Zalm stream, Sulaimani Province, Kurdistan Region, Iraq
DOI:
https://doi.org/10.21271/ZJPAS.32.4.11Keywords:
Cave leech, Erpobdella mestrovi, Morphology, Molecular, Iraq.Abstract
During survey of different water bodies in Kurdistan Region, Iraq for the presence of leeches, only two distinct specimens with special morphological characters were found in the cave mouth of Ahmadawa Water source in February 2019. The morphological (Body size, oral and posterior suckers characters, coloration and body projections were studied) and molecular study (18S rDNA amplifying with a forward primer C1 (ACCCGCTGAATTTAAGCAT at position 25), and reverse primer C3 (CTCTTCAGAGTACTTTTCAAC at position 390) and sequencing of the amplicons) cleared that the present specimens were belonging to the erpobdillid leeches, Erpobdella mestrovi, and the present appearance regard as a first in Iraq and all over the Middle-East for this leech.
References
ADDAY, T.K.; BALASEM, A.N.; MHAISEN, F.T. & AL-KHATEEB, G.H. (1999). A second survey of fish parasites from Tigris river at Al-Zaafaraniya, south of Baghdad. Ibn Al-Haitham J. Pure Appl. Sci., 12(1): 22-31.
AHMED, S. T. (2009). Biological studies on leeches in Erbil and its suburbs. A PhD dissertation/ Biology Dept./ College of Science- Salahaddin Univ.- Erbil. 113pp.
ALI, B.A.-R. (1989). Studies on parasites of some freshwater fishes from Greater Zab- Iski-Kalak. M. Sc. Thesis, Coll. Sci., Univ. Salahadden: 120pp. (In Arabic).
ALI, L. A. & JAWEIR, H. J. (2013). First record of Dina lineata (Hirudinea: Erpobdellidae) in Greater Zab river Kurdistan region-Iraq. J. Univ. Zakho, 1(A): 1: 207-209.
ALI, L. A. (2010). First record of Fadejewobdella quinqueannulata (Hirudinea: Erpobdellidae) in Greater Zab River-Iraq. Zanko J., 22 (2): 47-50.
AL-JAWDA, J. M.; BALASEM, A. N.; MHAISEN, F. T. & AL-KHATEEB, G.H. (2000). Parasitic fauna of fishes from Tigris river at Salah Al-Deen province, Iraq. Iraqi J. Biol. Sci., 19 & 20: 16-24.
AL-SALMANY, S. O. K. (2015). Parasitic infections of some fish species from Euphrates River at Al-Qaim city, Al-Anbar province. M. Sc. Thesis Department of Biology College of Science University of Tikrit. 193 pp. (In Arabic)
BASHÊ, S. K. R. (2008). The parasitic fauna of spiny eel Mastacembelus mastacembelus (Banks and Solanser, 1794) from Greater Zab River-Kuristan region-Iraq. M. Sc. Thesis, Sci. Edu. Coll., Univ. Salahaddin: 62pp.
BELY, A. E. & WEISBLAT, D. A. (2006). Lessons from leeches: a call for DNA barcoding in the lab. Evolution & Development, 8, 491–501.
BILAL, S. J.; ALI., A. A.; ABDULLAH, L. Y.; KHAILANY, R. A.; DHAHIR, S. F. & ABDULLAH, S. M.-A. (2017). First Record of Leech Dina Punctata (Annelida: Erpobdellidae) from Lesser Zab River in Northern Iraq: Morphological and Molecular Investigation. Jordan Journal of Biological Sciences, 10 (2): 69 – 72.
BORDA, E. & SIDDALL, M. E. (2004). Review of the evolution of life history strategies and phytogeny of the Hirudinida (Annelida: Oligochaeta). Lauterbornia 52: 5-25, D-86424 D inkelscherben.
BRINKHURST, R. O. (1999): Lumbriculids, branchiobdellidans and leeches: an overview of recent progress in phylogenetic research on clitellates.- Hydrobiologia, 406: 281-290, Dordrecht
CULVER, D.; PIPAN, C.; & TANJA, T. (2009). The biology of caves and other subterranean habitats. New York: Oxford University Press. 456-523 pp. ISBN 9780199219933. OCLC 248538645.
HERZOG, P. H. (1969). Untersuch-ungen über die parasiten der süBwasserfische des Irak. Arch. Fischereiwiss., 20(2/3): 132-147.
HOLT, P. C. (1989): Comments on the classification of the Clitellata. Hydrobiologia, 180: 1-5, Dordrecht.
KEROVEC, M.; KUČINIĆ, M. & JALŽIC, B. (1999). Croatobranchus mestrovi sp. n. -predstavnik nove endemske podzemne vrste pijavica. Spelolog 44/45, 35–36. (In Slovakian)
KHALIFA, K. A. (1985). Leeches on freshwater farmed fishes in Iraq. J. Wild. Dis., 21(3): 312-313.
KHALIFA, K.A. (1989). Incidence of parasitic infestation of fishes in Iraq. Pak. Vet. J., 9(2): 66-69.
MHAISEN, F. T. (1993). A review on the parasites and diseases in fishes of ponds and farms of Iraq. Iraqi J. Vet. Scs., 6(2): 20-27. (In Arabic).
MHAISEN, F. T. (2019). Index-catalogue of parasites and disease agents of fishes of Iraq, 24 pp. (Unpublished data)
MHAISEN, F. T.; AL-KHATEEB, G. H.; BALASEM, A. N. & MUTAR, A. J. (1997). On a collection of some fish parasites from Euphrates River, Anbar province, Iraq. Babylon. Univ. J., Pure. Appl. Sci., 2(3): 267-272.
MHAISEN, F.T. (1993). Fish parasites of Neinava province: A review and check- lists. Iraqi J. Vet. Med., 17: 110-125.
MOLLARET, I; JAMIESON, B. G. & JUSTINE, J. (2000). Phylogeny of the Monopisthocotylea and Polyopisthocotylea (Platyhelminthes) inferred from 28S rDNA sequences. Int. J. Parasitol, 30: 171–85.
NEUBERT, E. & NESEMANN, H. F. (1995). A new species of Batracobdella (Hirudinea, Glossiphoniidae) from Turkey. Zoology in the Middle East, 11(1):109-111. DOI: 10.1080/09397140.1995.10637679.
OCEGUERA-FIGUEROA, A.; LEO´N-RE`GAGNON, V. & SIDDALL, M. E. (2005). Phylogeny and revision of Erpobdelliformes (Annelida, Arhynchobdellidae) from Mexico based on nuclear and mitochondrial gene sequences. Revista Mexicana de Biodiversidad, 76, 191–198.
RAHEMO, Z. I. F. (1989). Cystibranchus mastacembeli (Annelida: Hirudinea) from the Iraqi freshwater spinyback, Mastacembelus simach (Wabaun, 1792). Riv. Parasitol., 6 (50) No. 1: 121-126.
RAHEMO, Z. I. F. (1996). Parasites of the Iraqi spinyback Mastacembelus simach (Walbaum, 1792). Iraqi J. Biol. Sci., 15: 42-52.
SHAMSUDDIN, M.; NADER, I.A. & AL-AZZAWI, M. J. (1971). Parasites of common fishes from Iraq with special reference to larval form of Contracaecum (Nematoda: Heterocheilidae). Bull. Biol. Res. Centre, Baghdad, 5: 66-78.
SKET, B. & TRONTELJ, P. (2008). Global diversity of leeches (Hirudinea) in freshwater. Hydrobiologia, 595: 129-137.
SKET, B.; DOVC, P.; JALŽIĆ, B. & TRONTELJ, P. (2001). Cave leech (Hirudinea, Erpobdellidae) from Croatia with unique morphological features. Zoologica Scripta, 30(3):223 – 229. DOI: 10.1046/j.1463-6409.2001.00065.
t activity of black and black mate tea polyphenols determined by ferrous tartrate and Folin–Ciocalteu methods. Food chemistry, 99, 835-841.
Downloads
Published
How to Cite
Issue
Section
License
Copyright (c) 2020 Shayan J. Hamad-Ali Hallaq, Luay A. Ali

This work is licensed under a Creative Commons Attribution 4.0 International License.




